Detail of EST/Unigene BI310605 |
Acc. | BI310605 |
Internal Acc. | EST5312355 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 33 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=2e-44; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=3e-23; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=2e-22; 30 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=4e-22; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=7e-22; |
Length | 703 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | GATTTCACACTCACCCTTAACTTCCCCACAGAACAACAACAACAACAACCATTTCTTCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824403 |
Trichome-related Gene from Literature | N/A |