Detail of EST/Unigene BI310632 |
Acc. | BI310632 |
Internal Acc. | EST5312382 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=8e-94; Protochlorophyllide reductase, chloroplastic OS=Daucus carota E-value=1e-91; Protochlorophyllide reductase B, chloroplastic OS=Arabidopsis thaliana E-value=2e-91; Protochlorophyllide reductase A, chloroplastic OS=Arabidopsis thaliana E-value=9e-91; Protochlorophyllide reductase B, chloroplastic OS=Hordeum vulgare E-value=7e-90; |
Length | 616 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | TGCTTGAGGACCTGGGCAAATCTGACTACCCTTCAAAGCGCTTGATCATTGTCGGCTCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.1.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828853 |
Trichome-related Gene from Literature | N/A |