Detail of EST/Unigene BI310698 |
Acc. | BI310698 |
Internal Acc. | EST5312448 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L2, chloroplastic OS=Nicotiana tabacum E-value=6e-47; 50S ribosomal protein L2, chloroplastic OS=Solanum tuberosum E-value=6e-47; 50S ribosomal protein L2, chloroplastic OS=Solanum lycopersicum E-value=6e-47; 50S ribosomal protein L2, chloroplastic OS=Solanum bulbocastanum E-value=6e-47; 50S ribosomal protein L2, chloroplastic OS=Panax ginseng E-value=6e-47; |
Length | 739 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | ACATTAAAATTACCTTCTGGAGAGGTCCGTTTGATATCAAAAAACTGCTCAGCAACAGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |