| Detail of EST/Unigene BI311175 |
| Acc. | BI311175 |
| Internal Acc. | EST5312925 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Vicianin hydrolase (Fragment) OS=Vicia sativa subsp. nigra E-value=6e-72; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=4e-44; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=3e-43; Beta-glucosidase 10 OS=Oryza sativa subsp. japonica E-value=4e-42; Beta-glucosidase 11 OS=Oryza sativa subsp. japonica E-value=4e-40; |
| Length | 639 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GESD; |
| Sequence | AACCCTATATCAACATGACCTACTTCACTGATATGCAAGCAAACCTCATTCCAATGAAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
| EC | 3.2.1.21 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819055 |
| Trichome-related Gene from Literature | N/A |