Detail of EST/Unigene BI311466 |
Acc. | BI311466 |
Internal Acc. | EST5313216 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Citrate synthase, glyoxysomal OS=Cucurbita maxima E-value=3e-68; Citrate synthase 2, peroxisomal OS=Arabidopsis thaliana E-value=6e-67; Citrate synthase 3, peroxisomal OS=Arabidopsis thaliana E-value=1e-64; Citrate synthase 1, peroxisomal OS=Arabidopsis thaliana E-value=7e-44; Citrate synthase, peroxisomal OS=Dictyostelium discoideum E-value=2e-41; |
Length | 676 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | ACACCGTGTCTACAAAACTACGATCCTAGAGCAAAGGTCTTAAAAAAATTGACCGAGGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825044 |
Trichome-related Gene from Literature | N/A |