Detail of EST/Unigene BI311722 |
Acc. | BI311722 |
Internal Acc. | EST5313472 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S3, mitochondrial OS=Petunia hybrida E-value=9e-88; Ribosomal protein S3, mitochondrial OS=Oenothera berteriana E-value=5e-86; Ribosomal protein S3, mitochondrial OS=Zea mays E-value=7e-83; Ribosomal protein S3, mitochondrial OS=Oryza sativa subsp. japonica E-value=2e-80; Ribosomal protein S3, mitochondrial OS=Arabidopsis thaliana E-value=1e-68; |
Length | 539 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | AATGTTGGAACCTCATGGGTAAGGATAAGGTAATGGAATTGATAGATAAATTAATAGACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |