| Detail of EST/Unigene BI311722 |
| Acc. | BI311722 |
| Internal Acc. | EST5313472 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S3, mitochondrial OS=Petunia hybrida E-value=9e-88; Ribosomal protein S3, mitochondrial OS=Oenothera berteriana E-value=5e-86; Ribosomal protein S3, mitochondrial OS=Zea mays E-value=7e-83; Ribosomal protein S3, mitochondrial OS=Oryza sativa subsp. japonica E-value=2e-80; Ribosomal protein S3, mitochondrial OS=Arabidopsis thaliana E-value=1e-68; |
| Length | 539 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GESD; |
| Sequence | AATGTTGGAACCTCATGGGTAAGGATAAGGTAATGGAATTGATAGATAAATTAATAGACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |