Detail of EST/Unigene BI311861 |
Acc. | BI311861 |
Internal Acc. | EST5313611 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | UTP--glucose-1-phosphate uridylyltransferase OS=Astragalus penduliflorus E-value=7e-33; UTP--glucose-1-phosphate uridylyltransferase OS=Pyrus pyrifolia E-value=1e-30; UTP--glucose-1-phosphate uridylyltransferase OS=Hordeum vulgare E-value=2e-30; UTP--glucose-1-phosphate uridylyltransferase OS=Musa acuminata E-value=3e-30; Probable UTP--glucose-1-phosphate uridylyltransferase 2 OS=Arabidopsis thaliana E-value=6e-30; |
Length | 230 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | GTTGATGGAGTAAAAGTTCTTCAGCTGGAAACTGCAGCTGGTGCAGCAATAAGGTTCTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00963 UTP--glucose-1-phosphate uridylyltransferase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K00963 UTP--glucose-1-phosphate uridylyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00963 UTP--glucose-1-phosphate uridylyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00963 UTP--glucose-1-phosphate uridylyltransferase |
EC | 2.7.7.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831596 |
Trichome-related Gene from Literature | N/A |