Detail of EST/Unigene BI421967 |
Acc. | BI421967 |
Internal Acc. | EST532633 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 1-aminocyclopropane-1-carboxylate synthase OS=Glycine max E-value=3e-98; 1-aminocyclopropane-1-carboxylate synthase OS=Nicotiana tabacum E-value=6e-97; 1-aminocyclopropane-1-carboxylate synthase 2 OS=Cucurbita pepo E-value=8e-97; 1-aminocyclopropane-1-carboxylate synthase CMW33 OS=Cucurbita maxima E-value=8e-97; 1-aminocyclopropane-1-carboxylate synthase 1 OS=Cucurbita pepo E-value=1e-96; |
Length | 819 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_TAMU_CALLUS; |
Sequence | CTTATAAACAACCCTTCAAATCCATTAGGTACTCTTCTTGACAAGGACACACTCCGTGAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
EC | 2.6.1.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825324 |
Trichome-related Gene from Literature | N/A |