| Detail of EST/Unigene BI422147 |
| Acc. | BI422147 |
| Internal Acc. | EST532813 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase B OS=Solanum lycopersicum E-value=3e-66; Glucan endo-1,3-beta-glucosidase, basic isoform 2 OS=Solanum tuberosum E-value=8e-61; Glucan endo-1,3-beta-glucosidase, basic isoform 3 (Fragment) OS=Solanum tuberosum E-value=2e-60; Glucan endo-1,3-beta-glucosidase, basic isoform 1 (Fragment) OS=Solanum tuberosum E-value=2e-60; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform GLB OS=Nicotiana tabacum E-value=2e-56; |
| Length | 579 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_TAMU_CALLUS; |
| Sequence | AATGTAATTGATGGTGTATTGAAATATACAACCTTACAAAAAGTTTCATTCCAGAATGAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824893 |
| Trichome-related Gene from Literature | 824893 |