| Detail of EST/Unigene BI921256 |
| Acc. | BI921256 |
| Internal Acc. | EST541159 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 9-divinyl ether synthase OS=Solanum lycopersicum E-value=0; 9-divinyl ether synthase OS=Solanum tuberosum E-value=2e-97; 9-divinyl ether synthase OS=Capsicum annuum E-value=2e-89; 9-divinyl ether synthase OS=Nicotiana tabacum E-value=5e-86; Allene oxide synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-54; |
| Length | 568 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_CALLUS; |
| Sequence | TTTGATCACATAACAAACTATTTACTTGCTTTAGTTAATGTGTTGAACGCAACATTTGGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00513 cytochrome P450, family 21, subfamily A (steroid 21-monooxygenase); ; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07437 cytochrome P450, family 26 |
| EC | 1.14.-.- 1.14.99.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834273 |
| Trichome-related Gene from Literature | 834273 |