| Detail of EST/Unigene BI921828 |
| Acc. | BI921828 |
| Internal Acc. | EST541731 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=0; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. indica E-value=0; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; Glutamate--cysteine ligase A, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; |
| Length | 699 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_CALLUS; |
| Sequence | TGCAGAGGTTAATTCACATCTTTACCAGGTTAAAGCTGTTGCAGAAGAGATGGGAATTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828409 |
| Trichome-related Gene from Literature | 828409 |