Detail of EST/Unigene BI925486 |
Acc. | BI925486 |
Internal Acc. | EST545375 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase 2 OS=Arabidopsis thaliana E-value=0; Farnesyl pyrophosphate synthase 1 OS=Lupinus albus E-value=2e-99; Farnesyl pyrophosphate synthase OS=Helianthus annuus E-value=2e-98; Farnesyl diphosphate synthase 1 OS=Artemisia spiciformis E-value=4e-98; Farnesyl pyrophosphate synthase 2 OS=Lupinus albus E-value=6e-98; |
Length | 732 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_flower_buds3; |
Sequence | CTCTGTCAAAAATGGCTGATCTGAAGAAGAAATTTTTGGATGTGTACTCTGTTCTTAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
EC | 2.5.1.1 2.5.1.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827430 |
Trichome-related Gene from Literature | 827430 |