| Detail of EST/Unigene BI926159 |
| Acc. | BI926159 |
| Internal Acc. | EST546048 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=0; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Homo sapiens E-value=1e-61; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Pongo abelii E-value=3e-61; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Homo sapiens E-value=3e-61; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Mus musculus E-value=6e-61; |
| Length | 772 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_flower_buds3; |
| Sequence | CATCAAGACATTCCTGATGCAAATATTTGAGAAATCTGGAAATACTGACATTGAAGGAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Lipid Metabolism > ko00072 Synthesis and degradation of ketone bodies > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01641 hydroxymethylglutaryl-CoA synthase |
| EC | 2.3.3.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826788 |
| Trichome-related Gene from Literature | 826788 |