Detail of EST/Unigene BI932888 |
Acc. | BI932888 |
Internal Acc. | EST552777 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=0; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Matthiola incana E-value=0; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=0; Flavanone 3-dioxygenase OS=Petroselinum crispum E-value=0; Naringenin,2-oxoglutarate 3-dioxygenase OS=Malus domestica E-value=0; |
Length | 675 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_FLOWER; |
Sequence | GCACCTTCAACACTAACAGCTTTAGCTAATGAAAAGACCCTTGAAACAAGTTTTATTAGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824287 |
Trichome-related Gene from Literature | 824287 |