Detail of EST/Unigene BI934418 |
Acc. | BI934418 |
Internal Acc. | EST554307 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-14; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-08; 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=1e-07; Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=3e-07; |
Length | 349 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_flower_anthesis; |
Sequence | TGAACAACTTGTTCATTTTCTCTCTGACTAAAATTTTTCATACAAAAATGGCAGTTTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827230 |
Trichome-related Gene from Literature | 827230 |