Detail of EST/Unigene BM409568
Acc. BM409568
Internal Acc. EST583895
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 60S ribosomal protein L3-2 OS=Arabidopsis thaliana E-value=3e-14; 60S ribosomal protein L3-1 OS=Arabidopsis thaliana E-value=7e-13; 60S ribosomal protein L3 OS=Rattus norvegicus E-value=1e-12; 60S ribosomal protein L3 OS=Macaca fascicularis E-value=1e-12; 60S ribosomal protein L3 OS=Homo sapiens E-value=1e-12;
Length 113 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_breaker_fruit;
Sequence TCCCCAGGAAGCGTGCTGCCAGACACAGGGGAAAGGTGAAGGCATTCCCAAAGGATGACC
CAAGCAAGCCTTGCAAGCTAACTGCCTTCTTGGGTTACAAGGCTGGAATGACT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology Genetic Information Processing > Translation > ko03010 Ribosome > K02925 large subunit ribosomal protein L3e
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 842454 
Trichome-related Gene from Literature 842454