Detail of EST/Unigene BM410054
Acc. BM410054
Internal Acc. EST584381
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=2e-22; 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=2e-21; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=2e-18; 3-ketoacyl-CoA thiolase, peroxisomal OS=Homo sapiens E-value=2e-08; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Mus musculus E-value=2e-08;
Length 159 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_breaker_fruit;
Sequence ACTAATGTGAACCCTAGTGAAGTTGGGGATATTGTTGTTGGCTCGGTGTTGGCCCCAGGT
TCCCAGAGGGCAAGTGAATGCAGGATGGCTGCATTTTATGCTGGTTTTCCTGAAACCGTG
CCAATTAGAACTGTAAACCGGCAATGTTCATCAAGCCTT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1;
Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1;
Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1;
Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1;
Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1
EC 2.3.1.16 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 839434 
Trichome-related Gene from Literature N/A