| Detail of EST/Unigene BM413087 |
| Acc. | BM413087 |
| Internal Acc. | EST587414 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-oxoacyl-[acyl-carrier-protein] synthase II, chloroplastic OS=Arabidopsis thaliana E-value=6e-17; 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic OS=Hordeum vulgare E-value=5e-08; 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic OS=Arabidopsis thaliana E-value=8e-08; |
| Length | 196 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_breaker_fruit; |
| Sequence | GCATCCGAATCGGCCATGGAAGCCGCACCAAAGAAGAAACCTCCAACCAAGGAAAGGCGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843835 |
| Trichome-related Gene from Literature | 843835 |