Detail of EST/Unigene BP137080 |
Acc. | BP137080 |
Internal Acc. | BP137080 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=5e-93; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=9e-78; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=4e-53; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=9e-52; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=3e-47; |
Length | 743 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_MAT001; |
Sequence | AGAAATATCACGACACATGGAATTTGTTGTGTCCACATAATCCATATGGAATGAGAAGGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |