Detail of EST/Unigene BP532396 |
Acc. | BP532396 |
Internal Acc. | BP532396 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=6e-71; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=4e-56; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=2e-54; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=5e-54; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=7e-54; |
Length | 450 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_MAT005; |
Sequence | ACCATGGTTATGAGAAGAAGCTTCCCTGGTACCGCGGCAAGGAATGGAGCTATCTTAGAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |