| Detail of EST/Unigene BP532901 |
| Acc. | BP532901 |
| Internal Acc. | BP532901 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=4e-18; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=3e-17; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=2e-16; Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=3e-16; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=4e-16; |
| Length | 462 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_MAT005; |
| Sequence | GAAGCTGTTGAAACTGCGAAGCAATTAGCGCTACAAGAAGGATTATTGGTTGGGATTTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.5.1.47 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818978 |
| Trichome-related Gene from Literature | 818978 |