Detail of EST/Unigene BP877645 |
Acc. | BP877645 |
Internal Acc. | BP877645 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 9S-lipoxygenase B OS=Solanum lycopersicum E-value=9e-87; Linoleate 9S-lipoxygenase A OS=Solanum lycopersicum E-value=3e-69; Linoleate 9S-lipoxygenase 6 (Fragment) OS=Solanum tuberosum E-value=5e-69; Linoleate 9S-lipoxygenase 1 OS=Solanum tuberosum E-value=5e-69; Probable linoleate 9S-lipoxygenase 3 OS=Solanum tuberosum E-value=9e-69; |
Length | 476 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_maturing_fruit; |
Sequence | GGAGGACGGATGAAGAATTTGGGAGAGAAATGTTGGCAGGATCCAATCCTGTCTTAATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08021 arachidonate 12-lipoxygenase (R-type) |
EC | 1.13.11.- 1.13.11.34 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821808 |
Trichome-related Gene from Literature | N/A |