| Detail of EST/Unigene BP879763 |
| Acc. | BP879763 |
| Internal Acc. | BP879763 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase OS=Hyoscyamus muticus E-value=5e-71; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=4e-53; Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=4e-52; Glutathione S-transferase F8, chloroplastic OS=Arabidopsis thaliana E-value=1e-42; Glutathione S-transferase F2 OS=Arabidopsis thaliana E-value=2e-41; |
| Length | 483 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_maturing_fruit; |
| Sequence | ACATCTCACACACAAATTTCATTTTCTACTTTCACTTTCTCTCTCTAGAAAACAAAAATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819386 |
| Trichome-related Gene from Literature | 819386 |