Detail of EST/Unigene BP881221 |
Acc. | BP881221 |
Internal Acc. | BP881221 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoenolpyruvate carboxylase OS=Solanum tuberosum E-value=6e-82; Phosphoenolpyruvate carboxylase OS=Nicotiana tabacum E-value=7e-80; Phosphoenolpyruvate carboxylase 2 OS=Mesembryanthemum crystallinum E-value=5e-79; Phosphoenolpyruvate carboxylase OS=Flaveria pringlei E-value=1e-78; Phosphoenolpyruvate carboxylase 2 OS=Flaveria trinervia E-value=1e-78; |
Length | 490 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_maturing_fruit; |
Sequence | GAGCTTCGTGATCGGGCAGATGAACTACACCGTTCATTAAAGAGAGACGAAAAACACTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01595 phosphoenolpyruvate carboxylase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K01595 phosphoenolpyruvate carboxylase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01595 phosphoenolpyruvate carboxylase |
EC | 4.1.1.31 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820723 |
Trichome-related Gene from Literature | N/A |