Detail of EST/Unigene BP884554 |
Acc. | BP884554 |
Internal Acc. | BP884554 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase large chain OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=4e-53; Carbamoyl-phosphate synthase large chain OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=5e-52; Carbamoyl-phosphate synthase large chain OS=Methanobrevibacter smithii (strain PS / ATCC 35061 / DSM 861) E-value=5e-47; Carbamoyl-phosphate synthase large chain OS=Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H) E-value=7e-45; Carbamoyl-phosphate synthase large chain OS=Archaeoglobus fulgidus (strain ATCC 49558 / VC-16 / DSM 4304 / JCM 9628 / NBRC 100126) E-value=7e-45; |
Length | 486 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_maturing_fruit; |
Sequence | AAAAATTAGTGAGATACCTTGAAAATGCTGTTAAGGTAGACCCAGAGCGCCCTGTCCTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01948 carbamoyl-phosphate synthase (ammonia) |
EC | 6.3.4.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839868 |
Trichome-related Gene from Literature | N/A |