| Detail of EST/Unigene BP886491 |
| Acc. | BP886491 |
| Internal Acc. | BP886491 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Taxus baccata E-value=4e-10; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Hordeum vulgare E-value=9e-10; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Petunia hybrida E-value=9e-10; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Ranunculus acris E-value=1e-09; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Magnolia liliiflora E-value=1e-09; |
| Length | 134 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_maturing_fruit; |
| Sequence | CTCCATTTTCCTTCTCAGTTCACAAAAAAACCCCTTGGGCAAGATTAAGATCGGAATCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.2.1.12 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819567 |
| Trichome-related Gene from Literature | 819567 |