Detail of EST/Unigene BP887537 |
Acc. | BP887537 |
Internal Acc. | BP887537 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Homo sapiens E-value=5e-22; Gamma-glutamyltranspeptidase 2 OS=Homo sapiens E-value=1e-21; Putative gamma-glutamyltranspeptidase 3 OS=Homo sapiens E-value=1e-20; Gamma-glutamyltranspeptidase 1 OS=Sus scrofa E-value=1e-20; Gamma-glutamyltranspeptidase 1 OS=Rattus norvegicus E-value=5e-20; |
Length | 478 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_maturing_fruit; |
Sequence | CTTGAGAAATTACAGAGTGGAAACTCCAGAAGCAGTTACTGTTAATGCTATGGGCTATAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
EC | 2.3.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829042 |
Trichome-related Gene from Literature | 829042 |