Detail of EST/Unigene BP889473 |
Acc. | BP889473 |
Internal Acc. | BP889473 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=8e-62; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=8e-60; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=8e-60; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Zea mays E-value=7e-59; UDP-arabinopyranose mutase 1 OS=Oryza sativa subsp. japonica E-value=7e-59; |
Length | 482 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_maturing_fruit; |
Sequence | AAAAAATGAAGGGAGTAAATCAATGAGATGTTGTTGCATCATGTGACACAATATGTAGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820039 |
Trichome-related Gene from Literature | 820039 |