| Detail of EST/Unigene BP898213 |
| Acc. | BP898213 |
| Internal Acc. | BP898213 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=4e-80; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=3e-79; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=6e-79; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=1e-78; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-78; |
| Length | 486 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_Lyc_leaf; |
| Sequence | GAGTTCATAATGGCTGCTTCTACTATGGCTCTTTCCTCCTCTACTTTCGCCGGTAAGGCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |