Detail of EST/Unigene BP905184 |
Acc. | BP905184 |
Internal Acc. | BP905184 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=5e-91; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=7e-91; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=7e-91; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=9e-91; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=1e-90; |
Length | 482 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_Lyc_leaf; |
Sequence | GAGTTCCCTGGTGATTACGGATGGGACACTGCTGGGCTTTCAGCTGACCCTGAAACATTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822391 |
Trichome-related Gene from Literature | N/A |