Detail of EST/Unigene BP906537 |
Acc. | BP906537 |
Internal Acc. | BP906537 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S17, chloroplastic OS=Arabidopsis thaliana E-value=2e-28; 30S ribosomal protein S17, chloroplastic (Fragment) OS=Pisum sativum E-value=2e-24; 30S ribosomal protein S17, chloroplastic OS=Zea mays E-value=2e-19; 30S ribosomal protein S17, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-19; 30S ribosomal protein S17 OS=Rickettsia bellii (strain RML369-C) E-value=2e-10; |
Length | 482 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_Lyc_leaf; |
Sequence | CACAATGTCTGTAACTTCTCCTCTTCTCTCTCAATTCAAATCCCTCACCATTTCCACCCN |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844324 |
Trichome-related Gene from Literature | 844324 |