| Detail of EST/Unigene BP909373 |
| Acc. | BP909373 |
| Internal Acc. | BP909373 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alpha,alpha-trehalose-phosphate synthase [UDP-forming] 1 OS=Arabidopsis thaliana E-value=9e-42; Probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 3 OS=Arabidopsis thaliana E-value=3e-21; Probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 4 OS=Arabidopsis thaliana E-value=4e-21; Probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 2 OS=Arabidopsis thaliana E-value=3e-14; |
| Length | 481 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_Lyc_leaf; |
| Sequence | TGGGGGAGATCGTACACAGTAAAGCCATCGCAACACCAATTGATTACGTTTTATGCATAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844194 |
| Trichome-related Gene from Literature | 844194 |