| Detail of EST/Unigene BQ122102 |
| Acc. | BQ122102 |
| Internal Acc. | EST607678 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxyacylglutathione hydrolase 3, mitochondrial OS=Arabidopsis thaliana E-value=7e-67; Protein ETHE1, mitochondrial OS=Mus musculus E-value=2e-42; Protein ETHE1, mitochondrial OS=Bos taurus E-value=9e-42; Protein ETHE1, mitochondrial OS=Homo sapiens E-value=1e-41; Hydroxyacylglutathione hydrolase OS=Cyanothece sp. (strain ATCC 51142) E-value=4e-09; |
| Length | 730 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD; |
| Sequence | ATCATTTCATTATTATATTAACAACCCAACATCAACAACATCGTCATTCATTCCTCTCCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.1.2.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841793 |
| Trichome-related Gene from Literature | N/A |