Detail of EST/Unigene BQ122102 |
Acc. | BQ122102 |
Internal Acc. | EST607678 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxyacylglutathione hydrolase 3, mitochondrial OS=Arabidopsis thaliana E-value=7e-67; Protein ETHE1, mitochondrial OS=Mus musculus E-value=2e-42; Protein ETHE1, mitochondrial OS=Bos taurus E-value=9e-42; Protein ETHE1, mitochondrial OS=Homo sapiens E-value=1e-41; Hydroxyacylglutathione hydrolase OS=Cyanothece sp. (strain ATCC 51142) E-value=4e-09; |
Length | 730 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | ATCATTTCATTATTATATTAACAACCCAACATCAACAACATCGTCATTCATTCCTCTCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.1.2.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841793 |
Trichome-related Gene from Literature | N/A |