Detail of EST/Unigene BQ122235
Acc. BQ122235
Internal Acc. EST607811
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 26S protease regulatory subunit 4 homolog OS=Oryza sativa subsp. japonica E-value=5e-10; 26S proteasome regulatory subunit 4 homolog B OS=Arabidopsis thaliana E-value=5e-10; 26S proteasome regulatory subunit 4 homolog A OS=Arabidopsis thaliana E-value=5e-10; Probable 26S protease regulatory subunit 4 OS=Caenorhabditis elegans E-value=3e-09; 26S protease regulatory subunit 4 OS=Rattus norvegicus E-value=3e-09;
Length 117 nt
Species Medicago truncatula
Belonged EST Libraries GLSD;
Sequence CAAAGGACTATGTTATATGCCGCTGAACCAGTTAGATGGTTTTGATTCAAGAGGAGATGT
AAAAGTGATTCTGGCTACCAACAGAATTGAAAGTCTTGATCCAGCTTTGCTACGACC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology Genetic Information Processing > Folding, Sorting and Degradation > ko03050 Proteasome > K03062 26S proteasome regulatory subunit T2
EC 3.6.1.3 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 829025 
Trichome-related Gene from Literature N/A