Detail of EST/Unigene BQ122244 |
Acc. | BQ122244 |
Internal Acc. | EST607820 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S8, chloroplastic OS=Glycine max E-value=6e-57; 30S ribosomal protein S8, chloroplastic OS=Lotus japonicus E-value=5e-56; 30S ribosomal protein S8, chloroplastic OS=Phaseolus angularis E-value=6e-55; 30S ribosomal protein S8, chloroplastic OS=Vitis vinifera E-value=2e-53; 30S ribosomal protein S8, chloroplastic OS=Phaseolus vulgaris E-value=4e-53; |
Length | 478 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | CCGGAGCACGTTTATTATATCGAAAGTAAGGAGCAATAATCTATCGTGGGTAAAGATACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |