Detail of EST/Unigene BQ122549 |
Acc. | BQ122549 |
Internal Acc. | EST608125 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS1 OS=Arabidopsis thaliana E-value=4e-46; Mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS2 OS=Arabidopsis thaliana E-value=5e-44; Mannosyl-oligosaccharide 1,2-alpha-mannosidase IC OS=Homo sapiens E-value=3e-14; Mannosyl-oligosaccharide 1,2-alpha-mannosidase IA (Fragment) OS=Oryctolagus cuniculus E-value=1e-11; Mannosyl-oligosaccharide 1,2-alpha-mannosidase IA OS=Mus musculus E-value=1e-11; |
Length | 329 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | GGTCACGCCGTCTTCCTTTACTTATATATGTGAGAAGAGCGGAGGATCTCTCACCGACAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00513 High-mannose type N-glycan biosynthesis > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00510 N-Glycan biosynthesis > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase |
EC | 3.2.1.113 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841584 |
Trichome-related Gene from Literature | N/A |