| Detail of EST/Unigene BQ122790 |
| Acc. | BQ122790 |
| Internal Acc. | EST608366 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L14, chloroplastic OS=Cicer arietinum E-value=3e-33; 50S ribosomal protein L14, chloroplastic OS=Glycine max E-value=2e-32; 50S ribosomal protein L14, chloroplastic OS=Phaseolus vulgaris E-value=3e-32; 50S ribosomal protein L14, chloroplastic OS=Cucumis sativus E-value=4e-32; 50S ribosomal protein L14, chloroplastic OS=Lotus japonicus E-value=7e-32; |
| Length | 553 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD; |
| Sequence | TATTAATTAATATAATGACTTACTATTTCTAATAACTTATCGATATGTATACTTTTCATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |