Detail of EST/Unigene BQ122790 |
Acc. | BQ122790 |
Internal Acc. | EST608366 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L14, chloroplastic OS=Cicer arietinum E-value=3e-33; 50S ribosomal protein L14, chloroplastic OS=Glycine max E-value=2e-32; 50S ribosomal protein L14, chloroplastic OS=Phaseolus vulgaris E-value=3e-32; 50S ribosomal protein L14, chloroplastic OS=Cucumis sativus E-value=4e-32; 50S ribosomal protein L14, chloroplastic OS=Lotus japonicus E-value=7e-32; |
Length | 553 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | TATTAATTAATATAATGACTTACTATTTCTAATAACTTATCGATATGTATACTTTTCATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |