| Detail of EST/Unigene BQ122858 |
| Acc. | BQ122858 |
| Internal Acc. | EST608434 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 1-Cys peroxiredoxin OS=Medicago truncatula E-value=0; 1-Cys peroxiredoxin PER1 OS=Triticum aestivum E-value=2e-76; 1-Cys peroxiredoxin PER1 OS=Hordeum vulgare E-value=9e-76; Probable 1-Cys peroxiredoxin (Fragment) OS=Bromus secalinus E-value=9e-76; 1-Cys peroxiredoxin A OS=Oryza sativa subsp. japonica E-value=1e-75; |
| Length | 560 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD; |
| Sequence | TGTTCTGATTCATGGACCATTCTCTTCTCTCATCCAGGTGATTTCACCCCAGTTTGTACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K00430 peroxidase; Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00430 peroxidase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00430 peroxidase; Metabolism > Biosynthesis of Secondary Metabolites > ko00960 Alkaloid biosynthesis II > K01066 esterase / lipase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00623 2,4-Dichlorobenzoate degradation > K01066 esterase / lipase |
| EC | 1.11.1.15 1.11.1.7 3.1.1.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841231 |
| Trichome-related Gene from Literature | N/A |