| Detail of EST/Unigene BQ123085 |
| Acc. | BQ123085 |
| Internal Acc. | EST608661 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71D9 OS=Glycine max E-value=2e-75; Premnaspirodiene oxygenase OS=Hyoscyamus muticus E-value=4e-51; Tabersonine 16-hydroxylase (Fragment) OS=Catharanthus roseus E-value=3e-50; Cytochrome P450 71D10 OS=Glycine max E-value=1e-49; Cytochrome P450 71D7 OS=Solanum chacoense E-value=2e-49; |
| Length | 692 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD; |
| Sequence | CAAGGACAGCCTTTTGCAAAAAGTGTAAAGAAAATCAGAAATTCATATCTATTGTAAGGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00513 cytochrome P450, family 21, subfamily A (steroid 21-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822234 |
| Trichome-related Gene from Literature | N/A |