Detail of EST/Unigene BQ123213 |
Acc. | BQ123213 |
Internal Acc. | EST608777 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=4e-50; 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=6e-50; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=1e-48; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=2e-48; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=4e-36; |
Length | 709 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | ACCTCACTCTTCTACACCAAATCCAAATCCCCATTCATCTCTAATTCCGTCAAACCCTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835090 |
Trichome-related Gene from Literature | N/A |