Detail of EST/Unigene BQ123267 |
Acc. | BQ123267 |
Internal Acc. | EST608843 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Caffeoyl-CoA O-methyltransferase OS=Medicago sativa E-value=4e-88; Probable caffeoyl-CoA O-methyltransferase At4g34050 OS=Arabidopsis thaliana E-value=1e-82; Caffeoyl-CoA O-methyltransferase OS=Vitis vinifera E-value=7e-82; Caffeoyl-CoA O-methyltransferase 5 OS=Nicotiana tabacum E-value=3e-81; Caffeoyl-CoA O-methyltransferase OS=Solanum tuberosum E-value=8e-81; |
Length | 483 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | GAGCATGCTCCTTAAACTTATCAATGCTAAGAACACCTTGGAAATTGGTGTCTACACTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00545 catechol O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00941 Flavonoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase |
EC | 2.1.1.104 2.1.1.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829551 |
Trichome-related Gene from Literature | N/A |