Detail of EST/Unigene BQ123562 |
Acc. | BQ123562 |
Internal Acc. | EST609126 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Xenopus tropicalis E-value=1e-22; Ubiquinone biosynthesis protein COQ9-A, mitochondrial OS=Xenopus laevis E-value=1e-21; Ubiquinone biosynthesis protein COQ9-B, mitochondrial OS=Xenopus laevis E-value=2e-21; Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Rattus norvegicus E-value=4e-21; Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Mus musculus E-value=4e-21; |
Length | 741 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | GGAATGTACCGAACGGCGGCGAAGCGGTTGCTGTGCAGCGCAAGGCAGTTCAACGGAAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838497 |
Trichome-related Gene from Literature | N/A |