Detail of EST/Unigene BQ123832 |
Acc. | BQ123832 |
Internal Acc. | EST609408 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=2e-48; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=4e-47; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=3e-46; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=2e-45; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-45; |
Length | 639 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | GGTCAGGTTGATAAACGCCGTATTGGAATGCTCCCGTTTGTTTTTTATGATACTTTTGGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |