Detail of EST/Unigene BQ123919 |
Acc. | BQ123919 |
Internal Acc. | EST609495 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 8 OS=Arabidopsis thaliana E-value=1e-31; Glucan endo-1,3-beta-glucosidase 6 OS=Arabidopsis thaliana E-value=1e-21; Glucan endo-1,3-beta-glucosidase 5 OS=Arabidopsis thaliana E-value=3e-20; Glucan endo-1,3-beta-glucosidase 9 OS=Arabidopsis thaliana E-value=5e-17; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=9e-13; |
Length | 589 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | TTCTTTCCTCTTATAAATATATACCATAGCTATTTATTAAGCTTCACTCCTATTTTTATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842784 |
Trichome-related Gene from Literature | N/A |