| Detail of EST/Unigene BQ124096 |
| Acc. | BQ124096 |
| Internal Acc. | EST609672 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Malate synthase, glyoxysomal (Fragment) OS=Glycine max E-value=8e-85; Malate synthase, glyoxysomal OS=Cucumis sativus E-value=2e-84; Malate synthase, glyoxysomal OS=Ricinus communis E-value=2e-81; Malate synthase, glyoxysomal OS=Cucurbita maxima E-value=2e-81; Malate synthase, glyoxysomal OS=Brassica napus E-value=1e-79; |
| Length | 508 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD; |
| Sequence | ATGGGAGGAATGGCAGCTCAAATTCTACTAAGAGATGATCCGGTGGCAAATGAAGCCGCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831690 |
| Trichome-related Gene from Literature | N/A |