Detail of EST/Unigene BQ124221 |
Acc. | BQ124221 |
Internal Acc. | EST609797 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 8 OS=Arabidopsis thaliana E-value=6e-50; Glucan endo-1,3-beta-glucosidase 6 OS=Arabidopsis thaliana E-value=5e-36; Glucan endo-1,3-beta-glucosidase 5 OS=Arabidopsis thaliana E-value=7e-35; Glucan endo-1,3-beta-glucosidase 9 OS=Arabidopsis thaliana E-value=8e-28; Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=1e-15; |
Length | 724 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | CCTCTTATAAATATAACATAGCTATTTATTAAGCTTCACTCCTATTTTTATAAGTGGGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842784 |
Trichome-related Gene from Literature | N/A |