| Detail of EST/Unigene BQ124386 |
| Acc. | BQ124386 |
| Internal Acc. | EST609962 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Secologanin synthase OS=Catharanthus roseus E-value=2e-57; Cytochrome P450 72C1 OS=Arabidopsis thaliana E-value=5e-38; Cytochrome P450 734A1 OS=Arabidopsis thaliana E-value=8e-36; Cytochrome P450 734A6 OS=Oryza sativa subsp. japonica E-value=1e-28; Cytochrome P450 734A2 OS=Oryza sativa subsp. japonica E-value=2e-26; |
| Length | 609 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD; |
| Sequence | CCAGTTAGAAAAATGTACGATCATGGCACCAAGTTTCCTCACAAGTTGCATTGATATGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
| EC | 1.14.13.98 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820690 |
| Trichome-related Gene from Literature | N/A |