| Detail of EST/Unigene BQ124430 |
| Acc. | BQ124430 |
| Internal Acc. | EST610006 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alpha-galactosidase OS=Cyamopsis tetragonoloba E-value=2e-44; Alpha-galactosidase OS=Oryza sativa subsp. japonica E-value=4e-43; Alpha-galactosidase OS=Coffea arabica E-value=8e-43; Probable alpha-galactosidase OS=Dictyostelium discoideum E-value=3e-24; Alpha-galactosidase D OS=Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) E-value=1e-16; |
| Length | 648 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD; |
| Sequence | GGAAGTTGGCAATGGTGGTTTCACTTACCAGGAATACCGTGGTCACTTCAGCATATGGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01189 alpha-galactosidase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K01189 alpha-galactosidase; Metabolism > Lipid Metabolism > ko00600 Sphingolipid metabolism > K01189 alpha-galactosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00603 Glycosphingolipid biosynthesis - globoseries > K01189 alpha-galactosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00603 Glycosphingolipid biosynthesis - globoseries > K01204 alpha-N-acetylgalactosaminidase |
| EC | 3.2.1.22 3.2.1.49 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824798 |
| Trichome-related Gene from Literature | N/A |