Detail of EST/Unigene BQ124593 |
Acc. | BQ124593 |
Internal Acc. | EST610169 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor A protein 1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-23; Replication protein A 70 kDa DNA-binding subunit OS=Xenopus tropicalis E-value=1e-22; Replication protein A 70 kDa DNA-binding subunit OS=Mus musculus E-value=3e-22; Replication protein A 70 kDa DNA-binding subunit OS=Xenopus laevis E-value=4e-22; Replication protein A 70 kDa DNA-binding subunit OS=Pongo abelii E-value=4e-22; |
Length | 639 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD; |
Sequence | ATTGCCGATGAAACCAAGAATAACTTGTTGTGTCTTTGTGGGGTGATCTTGCAACTAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03440 Homologous recombination > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K07466 replication factor A1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830696 |
Trichome-related Gene from Literature | N/A |