| Detail of EST/Unigene BQ124962 |
| Acc. | BQ124962 |
| Internal Acc. | EST610538 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=1e-68; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Glycine max E-value=7e-66; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=7e-65; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=2e-61; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Brassica napus E-value=7e-60; |
| Length | 421 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD; |
| Sequence | CTTGTACCATATCATGGATGGTGAATCAGTCATAGAACTCATCATCAAAACCATGGTCAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830441 |
| Trichome-related Gene from Literature | N/A |